Loading…
Microbiologist.in
Pharma QC microbiology, in your pocket
Quick Tm estimate for a primer sequence.
Note
20 nt, GC 50 %: basic Tm ≈ 51.8 °C (64.9 + 41 × (G+C − 16.4) / N). Salt-adjusted and nearest-neighbour methods are more accurate.
Reference: Wallace rule and the basic GC formula. Always follow your approved SOP and current pharmacopoeia.
Below 14 nt: Tm = 2(A+T) + 4(G+C); otherwise 64.9 + 41 × (G+C − 16.4) / N
AGCTAGCTAGCTAGCTAGCT (20 nt) → about 51.8 °C
Ignores salt and primer concentration; use nearest-neighbour tools for design.